Abstract
Bu sörvey programı Doğu Akdeniz bölgesi turungil alanlarında 1980’li
yılların ortalarında ilk defa belirlenen Citrus chlorotic dwarf (CCD, Turunçgil
klorotik cüceleşme) hastalığının son yaygınlık durumunu belirlemek için
yapılmıştır. Hastalık ilk belirlendiği yıllardan günümüze kadar bölge için çok
önemli hastalıklardan biri haline gelmiştir. Hastalık, günümüze kadar çok hızlı
bir şekilde yayılma göstermiştir. CCD hastalığı Türkiye turunçgil tarımının
yaklaşık % 85’ inin yapıldığı Doğu Akdeniz bölgesinde görülmektedir.
Türkiye’nin diğer turunçgil yetiştirilen alanlarında henüz rapor edilmemiştir.
Doğu Akdeniz bölgesi turunçgil alanlarında yapılan sörvey sonuçlarına göre
limonlarda %36, mandarinlerde %25,3, portakallarda % 17,6 ve altıntoplarda
%17,5 oranında infeksiyon gözlenmiştir. Sörvey makroskopik gözlemlere göre
hastalık simptomlarına bakılarak yapılmıştır. Hastalık olduğu belirlenen
bahçelerden 50 adet örnek alınmış ve bu örnekler PCR yöntemi ile analiz
edilmiştir. PCR çalışmaları forward (5′- gttctgtgtttcgacccgtt -3′) ve reverse
(5′- gggattcgcatggatagctcatccaa -3′) primerleri kullanılarak yapılmış ve daha
sonra yürütülen agar jel çalışmaları sonucu 444 bp seviyesinde bandlar
gözlenmiştir.
Keywords
References
- Çınar, A., Kersting, U., Önelge, N., Korkmaz, S., Şaş, G., 1993. Citrus virüs and virus- like disease in the eastern Mediterranean region of Turkey. In: Moreno, P., da Graça, J.V., Timmer, L.W. (Eds.). Proceedings of the 12th Conference of International Organization of Citrus Virologist, IOCV. Riverside, pp. 397–400.
- European Food Safety Authority, 2008. Pest risk assessment made by France on citrus chlorotic dwarf virus considered by France as harmful in the French overseas departments of French Guiana, Guadeloupe, Martinique and Re´ union. EFSA J. 684, 1–17.
- Kersting, U., Korkmaz, S., Çınar, A., Ertuğrul, B., Önelge, N., Garnsey, S. M., 1996. Citrus chlorotic dwarf: A new White fly-transmitted disease in the east Mediterranean region of Turkey. In: da Graça, J.V., Moreno, P., Yokomi, R. (Eds.). Proceedings of the 13th Conference of International Organizationof Citrus Virologist, IOCV. Riverside, pp. 220–225.
- Korkmaz, S., Çınar, A., Bozan, O., Kersting, U., 1994a. Distribution and natural transmission of a new whitefly-borne virüs disease of citrus in the eastern Mediterranean region of Turkey. In: Proceedings of the 9th Congress of the Mediterranean Phytopathological Union, pp. 437–439.
- Korkmaz, S., Çınar, A., Demirer, E., Önelge, N., 1994b. Greenhouse observation on the susceptibility of 36 citrus varieties to a new whitefly-borne virus. In: Proceedings of the 9th Congress of the Mediterranean Phytopathological Union, pp. 305–306.
- Korkmaz, S., Garnsey, S.M., 2000. Major virus disease: chlorotic dwarf. In: Timmer, P., Garnsey, S.M., Graham, T. (Eds.), In: Compendium of Citrus Diseases, 2nd Edition Pub. APS Press, pp. 55–56.
- Loconsole G., Saldarelli P., Doddapaneni H., Savino V., Martelli G.P., Saponari M., 2012. Identification of a single-stranded DNA virüs associated with citrus chlorotic dwarf disease, a new member in the family Geminiviridae. Virology 432 (2012) 162–172
- J. Guo, X. P. Lai, J. X. Li, J. Q. Yue, S. Y. Zhang, Y. Y. Li, J. Y. Gao, Z. R. Wang, H. F. Duan, and J. D. Yang, 2015. First Report on Citrus Chlorotic Dwarf Associated Virus on Lemon in Dehong Prefecture, Yunnan, China. Plant dise ase 99, 1287.
Abstract
References
- Çınar, A., Kersting, U., Önelge, N., Korkmaz, S., Şaş, G., 1993. Citrus virüs and virus- like disease in the eastern Mediterranean region of Turkey. In: Moreno, P., da Graça, J.V., Timmer, L.W. (Eds.). Proceedings of the 12th Conference of International Organization of Citrus Virologist, IOCV. Riverside, pp. 397–400.
- European Food Safety Authority, 2008. Pest risk assessment made by France on citrus chlorotic dwarf virus considered by France as harmful in the French overseas departments of French Guiana, Guadeloupe, Martinique and Re´ union. EFSA J. 684, 1–17.
- Kersting, U., Korkmaz, S., Çınar, A., Ertuğrul, B., Önelge, N., Garnsey, S. M., 1996. Citrus chlorotic dwarf: A new White fly-transmitted disease in the east Mediterranean region of Turkey. In: da Graça, J.V., Moreno, P., Yokomi, R. (Eds.). Proceedings of the 13th Conference of International Organizationof Citrus Virologist, IOCV. Riverside, pp. 220–225.
- Korkmaz, S., Çınar, A., Bozan, O., Kersting, U., 1994a. Distribution and natural transmission of a new whitefly-borne virüs disease of citrus in the eastern Mediterranean region of Turkey. In: Proceedings of the 9th Congress of the Mediterranean Phytopathological Union, pp. 437–439.
- Korkmaz, S., Çınar, A., Demirer, E., Önelge, N., 1994b. Greenhouse observation on the susceptibility of 36 citrus varieties to a new whitefly-borne virus. In: Proceedings of the 9th Congress of the Mediterranean Phytopathological Union, pp. 305–306.
- Korkmaz, S., Garnsey, S.M., 2000. Major virus disease: chlorotic dwarf. In: Timmer, P., Garnsey, S.M., Graham, T. (Eds.), In: Compendium of Citrus Diseases, 2nd Edition Pub. APS Press, pp. 55–56.
- Loconsole G., Saldarelli P., Doddapaneni H., Savino V., Martelli G.P., Saponari M., 2012. Identification of a single-stranded DNA virüs associated with citrus chlorotic dwarf disease, a new member in the family Geminiviridae. Virology 432 (2012) 162–172
- J. Guo, X. P. Lai, J. X. Li, J. Q. Yue, S. Y. Zhang, Y. Y. Li, J. Y. Gao, Z. R. Wang, H. F. Duan, and J. D. Yang, 2015. First Report on Citrus Chlorotic Dwarf Associated Virus on Lemon in Dehong Prefecture, Yunnan, China. Plant dise ase 99, 1287.
Details
| Primary Language | Turkish |
|---|---|
| Subjects | Agricultural Engineering |
| Journal Section | Research Article |
| Authors | |
| Publication Date | June 29, 2018 |
| Published in Issue | Year 2018 Volume: 33 Issue: 1 |
Cite
From January 1, 2016 “Çukurova University Journal of Faculty of Agriculture” continuous its publication life as “Çukurova Journal of Agriculture and Food Sciences”.